
Full text loading...
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.
Article metrics loading...
Full text loading...
References
Data & Media loading...
Supplements