1887

Abstract

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen contains RecA and LexA homologues, but their roles in have not been established. In this study, we identified the SOS regulon in by comparing the transcription profiles of a wild-type strain and a Δ mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene in cell elongation and inhibition of cell division. As anticipated, RecA of plays a role in mutagenesis; Δ cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by - and -promoter reporter studies. Stress-survival studies showed Δ mutant cells to be less resistant to heat, HO and acid exposure than wild-type cells. Our results indicate that the SOS response of contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

Loading

Article metrics loading...

/content/journal/micro/10.1099/mic.0.035196-0
2010-02-01
2020-04-07
Loading full text...

Full text loading...

/deliver/fulltext/micro/156/2/374.html?itemId=/content/journal/micro/10.1099/mic.0.035196-0&mimeType=html&fmt=ahah

References

  1. Au N., Kuester-Schoeck E., Mandava V., Bothwell L. E., Canny S. P., Chachu K., Colavito S. A., Fuller S. N., Groban E. S.. other authors 2005; Genetic composition of the Bacillus subtilis SOS system. J Bacteriol187:7655–7666
    [Google Scholar]
  2. Bailey T. L., Elkan C.. 1994; Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proceedings/International Conference on Intelligent Systems for Molecular Biology. ISMB2:28–36
    [Google Scholar]
  3. Boisivon A., Guiomar C., Carbon C.. 1990; In vitro bactericidal activity of amoxicillin, gentamicin, rifampicin, ciprofloxacin and trimethoprim-sulfamethoxazole alone or in combination against Listeria monocytogenes. Eur J Clin Microbiol Infect Dis9:206–209
    [Google Scholar]
  4. Chakraborty T., Leimeister-Wachter M., Domann E., Hartl M., Goebel W., Nichterlein T., Notermans S.. 1992; Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfA gene. J Bacteriol174:568–574
    [Google Scholar]
  5. Chauhan A., Lofton H., Maloney E., Moore J., Fol M., Madiraju M. V., Rajagopalan M.. 2006; Interference of Mycobacterium tuberculosis cell division by Rv2719c, a cell wall hydrolase. Mol Microbiol62:132–147
    [Google Scholar]
  6. Cirz R. T., O'Neill B. M., Hammond J. A., Head S. R., Romesberg F. E.. 2006; Defining the Pseudomonas aeruginosa SOS response and its role in the global response to the antibiotic ciprofloxacin. J Bacteriol188:7101–7110
    [Google Scholar]
  7. Cirz R. T., Jones M. B., Gingles N. A., Minogue T. D., Jarrahi B., Peterson S. N., Romesberg F. E.. 2007; Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J Bacteriol189:531–539
    [Google Scholar]
  8. Courcelle J., Hanawalt P. C.. 2003; RecA-dependent recovery of arrested DNA replication forks. Annu Rev Genet37:611–646
    [Google Scholar]
  9. Courcelle J., Khodursky A., Peter B., Brown P. O., Hanawalt P. C.. 2001; Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics158:41–64
    [Google Scholar]
  10. Cox M. M., Goodman M. F., Kreuzer K. N., Sherratt D. J., Sandler S. J., Marians K. J.. 2000; The importance of repairing stalled replication forks. Nature404:37–41
    [Google Scholar]
  11. Crooks G. E., Hon G., Chandonia J. M., Brenner S. E.. 2004; WebLogo: a sequence logo generator. Genome Res14:1188–1190
    [Google Scholar]
  12. da Rocha R. P., Paquola A. C., Marques Mdo V., Menck C. F., Galhardo R. S.. 2008; Characterization of the SOS regulon of Caulobacter crescentus. J Bacteriol190:1209–1218
    [Google Scholar]
  13. Derre I., Rapoport G., Msadek T.. 1999; CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Mol Microbiol31:117–131
    [Google Scholar]
  14. DiCapua E., Ruigrok R. W., Timmins P. A.. 1990; Activation of RecA protein: the salt-induced structural transition. J Struct Biol104:91–96
    [Google Scholar]
  15. Duigou S., Ehrlich S. D., Noirot P., Noirot-Gros M. F.. 2004; Distinctive genetic features exhibited by the Y-family DNA polymerases in Bacillus subtilis. Mol Microbiol54:439–451
    [Google Scholar]
  16. Duwat P., Ehrlich S. D., Gruss A.. 1995; The recA gene of Lactococcus lactis: characterization and involvement in oxidative and thermal stress. Mol Microbiol17:1121–1131
    [Google Scholar]
  17. Erill I., Campoy S., Barbe J.. 2007; Aeons of distress: an evolutionary perspective on the bacterial SOS response. FEMS Microbiol Rev31:637–656
    [Google Scholar]
  18. Foster P. L.. 2007; Stress-induced mutagenesis in bacteria. Crit Rev Biochem Mol Biol42:373–397
    [Google Scholar]
  19. Glaser P., Frangeul L., Buchrieser C., Rusniok C., Amend A., Baquero F., Berche P., Bloecker H., Brandt P.. other authors 2001; Comparative genomics of Listeria species. Science294:849–852
    [Google Scholar]
  20. Goodman M. F.. 2000; Coping with replication ‘train wrecks’ in Escherichia coli using Pol V, Pol II and RecA proteins. Trends Biochem Sci25:189–195
    [Google Scholar]
  21. Goranov A. I., Kuester-Schoeck E., Wang J. D., Grossman A. D.. 2006; Characterization of the global transcriptional responses to different types of DNA damage and disruption of replication in Bacillus subtilis. J Bacteriol188:5595–5605
    [Google Scholar]
  22. Hanawa T., Fukuda M., Kawakami H., Hirano H., Kamiya S., Yamamoto T.. 1999; The Listeria monocytogenes DnaK chaperone is required for stress tolerance and efficient phagocytosis with macrophages. Cell Stress Chaperones4:118–128
    [Google Scholar]
  23. Harfe B. D., Jinks-Robertson S.. 2000; DNA mismatch repair and genetic instability. Annu Rev Genet34:359–399
    [Google Scholar]
  24. Hosoya Y., Okamoto S., Muramatsu H., Ochi K.. 1998; Acquisition of certain streptomycin-resistant ( str) mutations enhances antibiotic production in bacteria. Antimicrob Agents Chemother42:2041–2047
    [Google Scholar]
  25. Huisman O., D'Ari R., Gottesman S.. 1984; Cell-division control in Escherichia coli: specific induction of the SOS function SfiA protein is sufficient to block septation. Proc Natl Acad Sci U S A81:4490–4494
    [Google Scholar]
  26. Jin H., Retallack D. M., Stelman S. J., Hershberger C. D., Ramseier T.. 2007; Characterization of the SOS response of Pseudomonas fluorescens strain DC206 using whole-genome transcript analysis. FEMS Microbiol Lett269:256–264
    [Google Scholar]
  27. Justice S. S., Hunstad D. A., Seed P. C., Hultgren S. J.. 2006; Filamentation by Escherichia coli subverts innate defenses during urinary tract infection. Proc Natl Acad Sci U S A103:19884–19889
    [Google Scholar]
  28. Kallipolitis B. H., Ingmer H.. 2001; Listeria monocytogenes response regulators important for stress tolerance and pathogenesis. FEMS Microbiol Lett204:111–115
    [Google Scholar]
  29. Kawai Y., Moriya S., Ogasawara N.. 2003; Identification of a protein, YneA, responsible for cell division suppression during the SOS response in Bacillus subtilis. Mol Microbiol47:1113–1122
    [Google Scholar]
  30. Kazmierczak M. J., Mithoe S. C., Boor K. J., Wiedmann M.. 2003; Listeria monocytogenes sigma B regulates stress response and virulence functions. J Bacteriol185:5722–5734
    [Google Scholar]
  31. Kelley W. L.. 2006; Lex marks the spot: the virulent side of SOS and a closer look at the LexA regulon. Mol Microbiol62:1228–1238
    [Google Scholar]
  32. Maul R. W., Sutton M. D.. 2005; Roles of the Escherichia coli RecA protein and the global SOS response in effecting DNA polymerase selection in vivo. J Bacteriol187:7607–7618
    [Google Scholar]
  33. Mead P. S., Slutsker L., Dietz V., McCaig L. F., Bresee J. S., Shapiro C., Griffin P. M., Tauxe R. V.. 1999; Food-related illness and death in the United States. Emerg Infect Dis5:607–625
    [Google Scholar]
  34. Monk I. R., Gahan C. G., Hill C.. 2008; Tools for functional postgenomic analysis of Listeria monocytogenes. Appl Environ Microbiol74:3921–3934
    [Google Scholar]
  35. Morse R., O'Hanlon K., Virji M., Collins M. D.. 1999; Isolation of rifampin-resistant mutants of Listeria monocytogenes and their characterization by rpoB gene sequencing, temperature sensitivity for growth, and interaction with an epithelial cell line. J Clin Microbiol37:2913–2919
    [Google Scholar]
  36. Napolitano R., Janel-Bintz R., Wagner J., Fuchs R. P.. 2000; All three SOS-inducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced mutagenesis. EMBO J19:6259–6265
    [Google Scholar]
  37. Ogino H., Teramoto H., Inui M., Yukawa H.. 2008; DivS, a novel SOS-inducible cell-division suppressor in Corynebacterium glutamicum. Mol Microbiol67:597–608
    [Google Scholar]
  38. Peyret N., Seneviratne P. A., Allawi H. T., SantaLucia J. Jr. 1999; Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A.A, C.C, G.G, and T.T mismatches. Biochemistry38:3468–3477
    [Google Scholar]
  39. Prieto A. I., Ramos-Morales F., Casadesus J.. 2004; Bile-induced DNA damage in Salmonella enterica. Genetics168:1787–1794
    [Google Scholar]
  40. Rothfield L., Taghbalout A., Shih Y. L.. 2005; Spatial control of bacterial division-site placement. Nat Rev Microbiol3:959–968
    [Google Scholar]
  41. Salmelin C., Vilpo J.. 2002; Chlorambucil-induced high mutation rate and suicidal gene downregulation in a base excision repair-deficient Escherichia coli strain. Mutat Res500:125–134
    [Google Scholar]
  42. Sambrook J., Fritsch E. F., Maniatis T.. 1989; Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory;
  43. Saulnier D. M., Molenaar D., de Vos W. M., Gibson G. R., Kolida S.. 2007; Identification of prebiotic fructooligosaccharide metabolism in Lactobacillus plantarum WCFS1 through microarrays. Appl Environ Microbiol73:1753–1765
    [Google Scholar]
  44. Schlacher K., Goodman M. F.. 2007; Lessons from 50 years of SOS DNA-damage-induced mutagenesis. Nat Rev Mol Cell Biol8:587–594
    [Google Scholar]
  45. Schlacher K., Cox M. M., Woodgate R., Goodman M. F.. 2006; RecA acts in trans to allow replication of damaged DNA by DNA polymerase V. Nature442:883–887
    [Google Scholar]
  46. Sleator R. D., Wemekamp-Kamphuis H. H., Gahan C. G., Abee T., Hill C.. 2005; A PrfA-regulated bile exclusion system (BilE) is a novel virulence factor in Listeria monocytogenes. Mol Microbiol55:1183–1195
    [Google Scholar]
  47. Sousa F. J., Lima L. M., Pacheco A. B., Oliveira C. L., Torriani I., Almeida D. F., Foguel D., Silva J. L., Mohana-Borges R.. 2006; Tetramerization of the LexA repressor in solution: implications for gene regulation of the E. coli SOS system at acidic pH. J Mol Biol359:1059–1074
    [Google Scholar]
  48. Sung H. M., Yeamans G., Ross C. A., Yasbin R. E.. 2003; Roles of YqjH and YqjW, homologs of the Escherichia coli UmuC/DinB or Y superfamily of DNA polymerases, in stationary-phase mutagenesis and UV-induced mutagenesis of Bacillus subtilis. J Bacteriol185:2153–2160
    [Google Scholar]
  49. van der Veen S., Hain T., Wouters J. A., Hossain H., de Vos W. M., Abee T., Chakraborty T., Wells-Bennik M. H.. 2007; The heat-shock response of Listeria monocytogenes comprises genes involved in heat shock, cell division, cell wall synthesis, and the SOS response. Microbiology153:3593–3607
    [Google Scholar]
  50. van der Veen S., Moezelaar R., Abee T., Wells-Bennik M. H.. 2008; The growth limits of a large number of Listeria monocytogenes strains at combinations of stresses show serotype- and niche-specific traits. J Appl Microbiol105:1246–1258
    [Google Scholar]
  51. Varhimo E., Savijoki K., Jalava J., Kuipers O. P., Varmanen P.. 2007; Identification of a novel streptococcal gene cassette mediating SOS mutagenesis in Streptococcus uberis. J Bacteriol189:5210–5222
    [Google Scholar]
  52. Wouters J. A., Hain T., Darji A., Hufner E., Wemekamp-Kamphuis H., Chakraborty T., Abee T.. 2005; Identification and characterization of di- and tripeptide transporter DtpT of Listeria monocytogenes EGD-e. Appl Environ Microbiol71:5771–5778
    [Google Scholar]
http://instance.metastore.ingenta.com/content/journal/micro/10.1099/mic.0.035196-0
Loading
/content/journal/micro/10.1099/mic.0.035196-0
Loading

Data & Media loading...

Most cited this month

This is a required field
Please enter a valid email address
Approval was a Success
Invalid data
An Error Occurred
Approval was partially successful, following selected items could not be processed due to error