1887

Abstract

The KstR-dependent promoter of the gene of , which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5′ untranslated region (5′UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the −5 and −35 positions with respect to the transcription start site. This region overlaps with the −10 and −35 boxes of the promoter, suggesting that KstR represses transcription by preventing the binding of RNA polymerase. Using a –β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like . A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar promoter regions have been found in all mycobacterial strains examined, with the sole exception of , provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Loading

Article metrics loading...

/content/journal/micro/10.1099/mic.0.049213-0
2011-09-01
2019-10-15
Loading full text...

Full text loading...

/deliver/fulltext/micro/157/9/2670.html?itemId=/content/journal/micro/10.1099/mic.0.049213-0&mimeType=html&fmt=ahah

References

  1. Av-Gay Y., Sobouti R.. ( 2000;). Cholesterol is accumulated by mycobacteria but its degradation is limited to non-pathogenic fast-growing mycobacteria. . Can J Microbiol 46:, 826–831. [CrossRef][PubMed]
    [Google Scholar]
  2. Baumeister R., Flache P., Melefors Ö., von Gabain A., Hillen W.. ( 1991;). Lack of a 5′ non-coding region in Tn1721 encoded tetR mRNA is associated with a low efficiency of translation and a short half-life in Escherichia coli. . Nucleic Acids Res 19:, 4595–4600. [CrossRef][PubMed]
    [Google Scholar]
  3. Capyk J. K., Kalscheuer R., Stewart G. R., Liu J., Kwon H., Zhao R., Okamoto S., Jacobs W. R. Jr, Eltis L. D., Mohn W. W.. ( 2009;). Mycobacterial cytochrome p450 125 (cyp125) catalyzes the terminal hydroxylation of c27 steroids. . J Biol Chem 284:, 35534–35542. [CrossRef][PubMed]
    [Google Scholar]
  4. Casadaban M. J.. ( 1976;). Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu. . J Mol Biol 104:, 541–555. [CrossRef][PubMed]
    [Google Scholar]
  5. Chang J. C., Harik N. S., Liao R. P., Sherman D. R.. ( 2007;). Identification of mycobacterial genes that alter growth and pathology in macrophages and in mice. . J Infect Dis 196:, 788–795. [CrossRef][PubMed]
    [Google Scholar]
  6. Chang J. C., Miner M. D., Pandey A. K., Gill W. P., Harik N. S., Sassetti C. M., Sherman D. R.. ( 2009;). igr genes and Mycobacterium tuberculosis cholesterol metabolism. . J Bacteriol 191:, 5232–5239. [CrossRef][PubMed]
    [Google Scholar]
  7. Combet C., Jambon M., Deléage G., Geourjon C.. ( 2002;). Geno3D: automatic comparative molecular modelling of protein. . Bioinformatics 18:, 213–214. [CrossRef][PubMed]
    [Google Scholar]
  8. de Lorenzo V., Herrero M., Jakubzik U., Timmis K. N.. ( 1990;). Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. . J Bacteriol 172:, 6568–6572.[PubMed]
    [Google Scholar]
  9. Donà V., Rodrigue S., Dainese E., Palù G., Gaudreau L., Manganelli R., Provvedi R.. ( 2008;). Evidence of complex transcriptional, translational, and posttranslational regulation of the extracytoplasmic function sigma factor sigmaE in Mycobacterium tuberculosis. . J Bacteriol 190:, 5963–5971. [CrossRef][PubMed]
    [Google Scholar]
  10. Dover L. G., Corsino P. E., Daniels I. R., Cocklin S. L., Tatituri V., Besra G. S., Fütterer K.. ( 2004;). Crystal structure of the TetR/CamR family repressor Mycobacterium tuberculosis EthR implicated in ethionamide resistance. . J Mol Biol 340:, 1095–1105. [CrossRef][PubMed]
    [Google Scholar]
  11. Ermolaeva M. D., Khalak H. G., White O., Smith H. O., Salzberg S. L.. ( 2000;). Prediction of transcription terminators in bacterial genomes. . J Mol Biol 301:, 27–33. [CrossRef][PubMed]
    [Google Scholar]
  12. Frénois F., Engohang-Ndong J., Locht C., Baulard A. R., Villeret V.. ( 2004;). Structure of EthR in a ligand bound conformation reveals therapeutic perspectives against tuberculosis. . Mol Cell 16:, 301–307. [CrossRef][PubMed]
    [Google Scholar]
  13. Galán B., Kolb A., Sanz J. M., García J. L., Prieto M. A.. ( 2003;). Molecular determinants of the hpa regulatory system of Escherichia coli: the HpaR repressor. . Nucleic Acids Res 31:, 6598–6609. [CrossRef][PubMed]
    [Google Scholar]
  14. Galvão T. C., de Lorenzo V.. ( 2006;). Transcriptional regulators à la carte: engineering new effector specificities in bacterial regulatory proteins. . Curr Opin Biotechnol 17:, 34–42. [CrossRef][PubMed]
    [Google Scholar]
  15. Gomez M., Smith I.. ( 2000;). Determinants of mycobacterial gene expression. . In Molecular Genetics of Mycobacteria, pp. 111–129. Edited by Hatfull G. F., Jacobs W. R. J... Washington, DC:: American Society for Microbiology;.
    [Google Scholar]
  16. Hu Y., van der Geize R., Besra G. S., Gurcha S. S., Liu A., Rohde M., Singh M., Coates A.. ( 2010;). 3-Ketosteroid 9α-hydroxylase is an essential factor in the pathogenesis of Mycobacterium tuberculosis. . Mol Microbiol 75:, 107–121. [CrossRef][PubMed]
    [Google Scholar]
  17. Janssen G. R.. ( 1993;). Eubacterial, archaebacterial, and eukaryotic genes that encode leaderless mRNA. . In Industrial Microorganisms: Basic and Applied Molecular Genetics, pp. 59–67. Edited by Baltz R. H., Hegeman G. D., Skatrud P. L... Washington, DC:: American Society for Microbiology;.
    [Google Scholar]
  18. Kendall S. L., Withers M., Soffair C. N., Moreland N. J., Gurcha S., Sidders B., Frita R., Ten Bokum A., Besra G. S. et al. ( 2007;). A highly conserved transcriptional repressor controls a large regulon involved in lipid degradation in Mycobacterium smegmatis and Mycobacterium tuberculosis. . Mol Microbiol 65:, 684–699. [CrossRef][PubMed]
    [Google Scholar]
  19. Kendall S. L., Burgess P., Balhana R., Withers M., Ten Bokum A., Lott J. S., Gao C., Uhia-Castro I., Stoker N. G.. ( 2010;). Cholesterol utilization in mycobacteria is controlled by two TetR-type transcriptional regulators: kstR and kstR2. . Microbiology 156:, 1362–1371. [CrossRef][PubMed]
    [Google Scholar]
  20. Klein U., Gimpl G., Fahrenholz F.. ( 1995;). Alteration of the myometrial plasma membrane cholesterol content with β-cyclodextrin modulates the binding affinity of the oxytocin receptor. . Biochemistry 34:, 13784–13793. [CrossRef][PubMed]
    [Google Scholar]
  21. Knol J., Bodewits K., Hessels G. I., Dijkhuizen L., van der Geize R.. ( 2008;). 3-Keto-5α-steroid Δ1-dehydrogenase from Rhodococcus erythropolis SQ1 and its orthologue in Mycobacterium tuberculosis H37Rv are highly specific enzymes that function in cholesterol catabolism. . Biochem J 410:, 339–346. [CrossRef][PubMed]
    [Google Scholar]
  22. Lack N. A., Yam K. C., Lowe E. D., Horsman G. P., Owen R. L., Sim E., Eltis L. D.. ( 2010;). Characterization of a carbon-carbon hydrolase from Mycobacterium tuberculosis involved in cholesterol metabolism. . J Biol Chem 285:, 434–443. [CrossRef][PubMed]
    [Google Scholar]
  23. Laemmli U. K.. ( 1970;). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. . Nature 227:, 680–685. [CrossRef][PubMed]
    [Google Scholar]
  24. Maxam A. M., Gilbert W.. ( 1977;). A new method for sequencing DNA. . Proc Natl Acad Sci U S A 74:, 560–564. [CrossRef][PubMed]
    [Google Scholar]
  25. Miner M. D., Chang J. C., Pandey A. K., Sassetti C. M., Sherman D. R.. ( 2009;). Role of cholesterol in Mycobacterium tuberculosis infection. . Indian J Exp Biol 47:, 407–411.[PubMed]
    [Google Scholar]
  26. Moll I., Grill S., Gualerzi C. O., Bläsi U.. ( 2002;). Leaderless mRNAs in bacteria: surprises in ribosomal recruitment and translational control. . Mol Microbiol 43:, 239–246. [CrossRef][PubMed]
    [Google Scholar]
  27. Moreno-Ruiz E., Hernáez M. J., Martínez-Pérez O., Santero E.. ( 2003;). Identification and functional characterization of Sphingomonas macrogolitabida strain TFA genes involved in the first two steps of the tetralin catabolic pathway. . J Bacteriol 185:, 2026–2030. [CrossRef][PubMed]
    [Google Scholar]
  28. Nauta A., van Sinderen D., Karsens H., Smit E., Venema G., Kok J.. ( 1996;). Inducible gene expression mediated by a repressor-operator system isolated from Lactococcus lactis bacteriophage r1t. . Mol Microbiol 19:, 1331–1341. [CrossRef][PubMed]
    [Google Scholar]
  29. Nesbitt N. M., Yang X., Fontán P., Kolesnikova I., Smith I., Sampson N. S., Dubnau E.. ( 2010;). A thiolase of Mycobacterium tuberculosis is required for virulence and production of androstenedione and androstadienedione from cholesterol. . Infect Immun 78:, 275–282. [CrossRef][PubMed]
    [Google Scholar]
  30. Nguyen D. H., Taub D. D.. ( 2003;). Inhibition of chemokine receptor function by membrane cholesterol oxidation. . Exp Cell Res 291:, 36–45. [CrossRef][PubMed]
    [Google Scholar]
  31. Orth P., Schnappinger D., Hillen W., Saenger W., Hinrichs W.. ( 2000;). Structural basis of gene regulation by the tetracycline inducible Tet repressor-operator system. . Nat Struct Biol 7:, 215–219. [CrossRef][PubMed]
    [Google Scholar]
  32. Pandey A. K., Sassetti C. M.. ( 2008;). Mycobacterial persistence requires the utilization of host cholesterol. . Proc Natl Acad Sci U S A 105:, 4376–4380. [CrossRef][PubMed]
    [Google Scholar]
  33. Prieto M. A., García J. L.. ( 1997;). Identification of a novel positive regulator of the 4-hydroxyphenylacetate catabolic pathway of Escherichia coli. . Biochem Biophys Res Commun 232:, 759–765. [CrossRef][PubMed]
    [Google Scholar]
  34. Ramos J. L., Martínez-Bueno M., Molina-Henares A. J., Terán W., Watanabe K., Zhang X., Gallegos M. T., Brennan R., Tobes R.. ( 2005;). The TetR family of transcriptional repressors. . Microbiol Mol Biol Rev 69:, 326–356. [CrossRef][PubMed]
    [Google Scholar]
  35. Rengarajan J., Bloom B. R., Rubin E. J.. ( 2005;). Genome-wide requirements for Mycobacterium tuberculosis adaptation and survival in macrophages. . Proc Natl Acad Sci U S A 102:, 8327–8332. [CrossRef][PubMed]
    [Google Scholar]
  36. Sambrook J., Russell D. W.. ( 2001;). Molecular Cloning: A Laboratory Manual, , 3rd edn.. Cold Spring Harbor, NY:: Cold Spring Harbor Laboratory;.
    [Google Scholar]
  37. Sassetti C. M., Rubin E. J.. ( 2003;). Genetic requirements for mycobacterial survival during infection. . Proc Natl Acad Sci U S A 100:, 12989–12994. [CrossRef][PubMed]
    [Google Scholar]
  38. Schnappinger D., Ehrt S., Voskuil M. I., Liu Y., Mangan J. A., Monahan I. M., Dolganov G., Efron B., Butcher P. D. et al. ( 2003;). Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. . J Exp Med 198:, 693–704. [CrossRef][PubMed]
    [Google Scholar]
  39. Slupska M. M., King A. G., Fitz-Gibbon S., Besemer J., Borodovsky M., Miller J. H.. ( 2001;). Leaderless transcripts of the crenarchaeal hyperthermophile Pyrobaculum aerophilum. . J Mol Biol 309:, 347–360. [CrossRef][PubMed]
    [Google Scholar]
  40. Snapper S. B., Melton R. E., Mustafa S., Kieser T., Jacobs W. R. J. Jr. ( 1990;). Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. . Mol Microbiol 4:, 1911–1919. [CrossRef][PubMed]
    [Google Scholar]
  41. Söding J.. ( 2005;). Protein homology detection by HMM-HMM comparison. . Bioinformatics 21:, 951–960. [CrossRef][PubMed]
    [Google Scholar]
  42. Tolstrup N., Sensen C. W., Garrett R. A., Clausen I. G.. ( 2000;). Two different and highly organized mechanisms of translation initiation in the archaeon Sulfolobus solfataricus. . Extremophiles 4:, 175–179. [CrossRef][PubMed]
    [Google Scholar]
  43. Uhía I., Galán B., Morales V., García J. L.. ( 2011;). Initial step in the catabolism of cholesterol by Mycobacterium smegmatis mc2155. . Environ Microbiol 13:, 943–959. [CrossRef][PubMed]
    [Google Scholar]
  44. Walz A., Pirrotta V., Ineichen K.. ( 1976;). Lambda repressor regulates the switch between PR and Prm promoters. . Nature 262:, 665–669. [CrossRef][PubMed]
    [Google Scholar]
  45. Wirth R., Friesenegger A., Fiedler S.. ( 1989;). Transformation of various species of gram-negative bacteria belonging to 11 different genera by electroporation. . Mol Gen Genet 216:, 175–177. [CrossRef][PubMed]
    [Google Scholar]
  46. Yam K. C., D’Angelo I., Kalscheuer R., Zhu H., Wang J. X., Snieckus V., Ly L. H., Converse P. J., Jacobs W. R. Jr et al. ( 2009;). Studies of a ring-cleaving dioxygenase illuminate the role of cholesterol metabolism in the pathogenesis of Mycobacterium tuberculosis. . PLoS Pathog 5:, e1000344. [CrossRef][PubMed]
    [Google Scholar]
  47. Yang X., Dubnau E., Smith I., Sampson N. S.. ( 2007;). Rv1106c from Mycobacterium tuberculosis is a 3β-hydroxysteroid dehydrogenase. . Biochemistry 46:, 9058–9067. [CrossRef][PubMed]
    [Google Scholar]
http://instance.metastore.ingenta.com/content/journal/micro/10.1099/mic.0.049213-0
Loading
/content/journal/micro/10.1099/mic.0.049213-0
Loading

Data & Media loading...

Supplements

vol. , part 9, pp. 2670 - 2680

Transcriptional analysis of the operon [PDF](104 kb)



PDF
This is a required field
Please enter a valid email address
Approval was a Success
Invalid data
An Error Occurred
Approval was partially successful, following selected items could not be processed due to error