1887

Abstract

The KstR-dependent promoter of the gene of , which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5′ untranslated region (5′UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the −5 and −35 positions with respect to the transcription start site. This region overlaps with the −10 and −35 boxes of the promoter, suggesting that KstR represses transcription by preventing the binding of RNA polymerase. Using a –β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like . A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar promoter regions have been found in all mycobacterial strains examined, with the sole exception of , provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Loading

Article metrics loading...

/content/journal/micro/10.1099/mic.0.049213-0
2011-09-01
2020-07-03
Loading full text...

Full text loading...

/deliver/fulltext/micro/157/9/2670.html?itemId=/content/journal/micro/10.1099/mic.0.049213-0&mimeType=html&fmt=ahah

References

  1. Av-Gay Y., Sobouti R..( 2000;). Cholesterol is accumulated by mycobacteria but its degradation is limited to non-pathogenic fast-growing mycobacteria. Can J Microbiol46:826–831 [CrossRef][PubMed]
    [Google Scholar]
  2. Baumeister R., Flache P., Melefors Ö., von Gabain A., Hillen W..( 1991;). Lack of a 5′ non-coding region in Tn1721 encoded tetR mRNA is associated with a low efficiency of translation and a short half-life in Escherichia coli. Nucleic Acids Res19:4595–4600 [CrossRef][PubMed]
    [Google Scholar]
  3. Capyk J. K., Kalscheuer R., Stewart G. R., Liu J., Kwon H., Zhao R., Okamoto S., Jacobs W. R. Jr, Eltis L. D., Mohn W. W..( 2009;). Mycobacterial cytochrome p450 125 (cyp125) catalyzes the terminal hydroxylation of c27 steroids. J Biol Chem284:35534–35542 [CrossRef][PubMed]
    [Google Scholar]
  4. Casadaban M. J..( 1976;). Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu. J Mol Biol104:541–555 [CrossRef][PubMed]
    [Google Scholar]
  5. Chang J. C., Harik N. S., Liao R. P., Sherman D. R..( 2007;). Identification of mycobacterial genes that alter growth and pathology in macrophages and in mice. J Infect Dis196:788–795 [CrossRef][PubMed]
    [Google Scholar]
  6. Chang J. C., Miner M. D., Pandey A. K., Gill W. P., Harik N. S., Sassetti C. M., Sherman D. R..( 2009;). igr genes and Mycobacterium tuberculosis cholesterol metabolism. J Bacteriol191:5232–5239 [CrossRef][PubMed]
    [Google Scholar]
  7. Combet C., Jambon M., Deléage G., Geourjon C..( 2002;). Geno3D: automatic comparative molecular modelling of protein. Bioinformatics18:213–214 [CrossRef][PubMed]
    [Google Scholar]
  8. de Lorenzo V., Herrero M., Jakubzik U., Timmis K. N..( 1990;). Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J Bacteriol172:6568–6572[PubMed]
    [Google Scholar]
  9. Donà V., Rodrigue S., Dainese E., Palù G., Gaudreau L., Manganelli R., Provvedi R..( 2008;). Evidence of complex transcriptional, translational, and posttranslational regulation of the extracytoplasmic function sigma factor sigmaE in Mycobacterium tuberculosis. J Bacteriol190:5963–5971 [CrossRef][PubMed]
    [Google Scholar]
  10. Dover L. G., Corsino P. E., Daniels I. R., Cocklin S. L., Tatituri V., Besra G. S., Fütterer K..( 2004;). Crystal structure of the TetR/CamR family repressor Mycobacterium tuberculosis EthR implicated in ethionamide resistance. J Mol Biol340:1095–1105 [CrossRef][PubMed]
    [Google Scholar]
  11. Ermolaeva M. D., Khalak H. G., White O., Smith H. O., Salzberg S. L..( 2000;). Prediction of transcription terminators in bacterial genomes. J Mol Biol301:27–33 [CrossRef][PubMed]
    [Google Scholar]
  12. Frénois F., Engohang-Ndong J., Locht C., Baulard A. R., Villeret V..( 2004;). Structure of EthR in a ligand bound conformation reveals therapeutic perspectives against tuberculosis. Mol Cell16:301–307 [CrossRef][PubMed]
    [Google Scholar]
  13. Galán B., Kolb A., Sanz J. M., García J. L., Prieto M. A..( 2003;). Molecular determinants of the hpa regulatory system of Escherichia coli: the HpaR repressor. Nucleic Acids Res31:6598–6609 [CrossRef][PubMed]
    [Google Scholar]
  14. Galvão T. C., de Lorenzo V..( 2006;). Transcriptional regulators à la carte: engineering new effector specificities in bacterial regulatory proteins. Curr Opin Biotechnol17:34–42 [CrossRef][PubMed]
    [Google Scholar]
  15. Gomez M., Smith I..( 2000;). Determinants of mycobacterial gene expression. Molecular Genetics of Mycobacteria111–129 Hatfull G. F., Jacobs W. R. J.. Washington, DC: American Society for Microbiology;
    [Google Scholar]
  16. Hu Y., van der Geize R., Besra G. S., Gurcha S. S., Liu A., Rohde M., Singh M., Coates A..( 2010;). 3-Ketosteroid 9α-hydroxylase is an essential factor in the pathogenesis of Mycobacterium tuberculosis. Mol Microbiol75:107–121 [CrossRef][PubMed]
    [Google Scholar]
  17. Janssen G. R..( 1993;). Eubacterial, archaebacterial, and eukaryotic genes that encode leaderless mRNA. Industrial Microorganisms: Basic and Applied Molecular Genetics59–67 Baltz R. H., Hegeman G. D., Skatrud P. L.. Washington, DC: American Society for Microbiology;
    [Google Scholar]
  18. Kendall S. L., Withers M., Soffair C. N., Moreland N. J., Gurcha S., Sidders B., Frita R., Ten Bokum A., Besra G. S. et al.( 2007;). A highly conserved transcriptional repressor controls a large regulon involved in lipid degradation in Mycobacterium smegmatis and Mycobacterium tuberculosis. Mol Microbiol65:684–699 [CrossRef][PubMed]
    [Google Scholar]
  19. Kendall S. L., Burgess P., Balhana R., Withers M., Ten Bokum A., Lott J. S., Gao C., Uhia-Castro I., Stoker N. G..( 2010;). Cholesterol utilization in mycobacteria is controlled by two TetR-type transcriptional regulators: kstR and kstR2. Microbiology156:1362–1371 [CrossRef][PubMed]
    [Google Scholar]
  20. Klein U., Gimpl G., Fahrenholz F..( 1995;). Alteration of the myometrial plasma membrane cholesterol content with β-cyclodextrin modulates the binding affinity of the oxytocin receptor. Biochemistry34:13784–13793 [CrossRef][PubMed]
    [Google Scholar]
  21. Knol J., Bodewits K., Hessels G. I., Dijkhuizen L., van der Geize R..( 2008;). 3-Keto-5α-steroid Δ1-dehydrogenase from Rhodococcus erythropolis SQ1 and its orthologue in Mycobacterium tuberculosis H37Rv are highly specific enzymes that function in cholesterol catabolism. Biochem J410:339–346 [CrossRef][PubMed]
    [Google Scholar]
  22. Lack N. A., Yam K. C., Lowe E. D., Horsman G. P., Owen R. L., Sim E., Eltis L. D..( 2010;). Characterization of a carbon-carbon hydrolase from Mycobacterium tuberculosis involved in cholesterol metabolism. J Biol Chem285:434–443 [CrossRef][PubMed]
    [Google Scholar]
  23. Laemmli U. K..( 1970;). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature227:680–685 [CrossRef][PubMed]
    [Google Scholar]
  24. Maxam A. M., Gilbert W..( 1977;). A new method for sequencing DNA. Proc Natl Acad Sci U S A74:560–564 [CrossRef][PubMed]
    [Google Scholar]
  25. Miner M. D., Chang J. C., Pandey A. K., Sassetti C. M., Sherman D. R..( 2009;). Role of cholesterol in Mycobacterium tuberculosis infection. Indian J Exp Biol47:407–411[PubMed]
    [Google Scholar]
  26. Moll I., Grill S., Gualerzi C. O., Bläsi U..( 2002;). Leaderless mRNAs in bacteria: surprises in ribosomal recruitment and translational control. Mol Microbiol43:239–246 [CrossRef][PubMed]
    [Google Scholar]
  27. Moreno-Ruiz E., Hernáez M. J., Martínez-Pérez O., Santero E..( 2003;). Identification and functional characterization of Sphingomonas macrogolitabida strain TFA genes involved in the first two steps of the tetralin catabolic pathway. J Bacteriol185:2026–2030 [CrossRef][PubMed]
    [Google Scholar]
  28. Nauta A., van Sinderen D., Karsens H., Smit E., Venema G., Kok J..( 1996;). Inducible gene expression mediated by a repressor-operator system isolated from Lactococcus lactis bacteriophage r1t. Mol Microbiol19:1331–1341 [CrossRef][PubMed]
    [Google Scholar]
  29. Nesbitt N. M., Yang X., Fontán P., Kolesnikova I., Smith I., Sampson N. S., Dubnau E..( 2010;). A thiolase of Mycobacterium tuberculosis is required for virulence and production of androstenedione and androstadienedione from cholesterol. Infect Immun78:275–282 [CrossRef][PubMed]
    [Google Scholar]
  30. Nguyen D. H., Taub D. D..( 2003;). Inhibition of chemokine receptor function by membrane cholesterol oxidation. Exp Cell Res291:36–45 [CrossRef][PubMed]
    [Google Scholar]
  31. Orth P., Schnappinger D., Hillen W., Saenger W., Hinrichs W..( 2000;). Structural basis of gene regulation by the tetracycline inducible Tet repressor-operator system. Nat Struct Biol7:215–219 [CrossRef][PubMed]
    [Google Scholar]
  32. Pandey A. K., Sassetti C. M..( 2008;). Mycobacterial persistence requires the utilization of host cholesterol. Proc Natl Acad Sci U S A105:4376–4380 [CrossRef][PubMed]
    [Google Scholar]
  33. Prieto M. A., García J. L..( 1997;). Identification of a novel positive regulator of the 4-hydroxyphenylacetate catabolic pathway of Escherichia coli. Biochem Biophys Res Commun232:759–765 [CrossRef][PubMed]
    [Google Scholar]
  34. Ramos J. L., Martínez-Bueno M., Molina-Henares A. J., Terán W., Watanabe K., Zhang X., Gallegos M. T., Brennan R., Tobes R..( 2005;). The TetR family of transcriptional repressors. Microbiol Mol Biol Rev69:326–356 [CrossRef][PubMed]
    [Google Scholar]
  35. Rengarajan J., Bloom B. R., Rubin E. J..( 2005;). Genome-wide requirements for Mycobacterium tuberculosis adaptation and survival in macrophages. Proc Natl Acad Sci U S A102:8327–8332 [CrossRef][PubMed]
    [Google Scholar]
  36. Sambrook J., Russell D. W..( 2001;). Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory;
    [Google Scholar]
  37. Sassetti C. M., Rubin E. J..( 2003;). Genetic requirements for mycobacterial survival during infection. Proc Natl Acad Sci U S A100:12989–12994 [CrossRef][PubMed]
    [Google Scholar]
  38. Schnappinger D., Ehrt S., Voskuil M. I., Liu Y., Mangan J. A., Monahan I. M., Dolganov G., Efron B., Butcher P. D. et al.( 2003;). Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J Exp Med198:693–704 [CrossRef][PubMed]
    [Google Scholar]
  39. Slupska M. M., King A. G., Fitz-Gibbon S., Besemer J., Borodovsky M., Miller J. H..( 2001;). Leaderless transcripts of the crenarchaeal hyperthermophile Pyrobaculum aerophilum. J Mol Biol309:347–360 [CrossRef][PubMed]
    [Google Scholar]
  40. Snapper S. B., Melton R. E., Mustafa S., Kieser T., Jacobs W. R. J. Jr.( 1990;). Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol Microbiol4:1911–1919 [CrossRef][PubMed]
    [Google Scholar]
  41. Söding J..( 2005;). Protein homology detection by HMM-HMM comparison. Bioinformatics21:951–960 [CrossRef][PubMed]
    [Google Scholar]
  42. Tolstrup N., Sensen C. W., Garrett R. A., Clausen I. G..( 2000;). Two different and highly organized mechanisms of translation initiation in the archaeon Sulfolobus solfataricus. Extremophiles4:175–179 [CrossRef][PubMed]
    [Google Scholar]
  43. Uhía I., Galán B., Morales V., García J. L..( 2011;). Initial step in the catabolism of cholesterol by Mycobacterium smegmatis mc2155. Environ Microbiol13:943–959 [CrossRef][PubMed]
    [Google Scholar]
  44. Walz A., Pirrotta V., Ineichen K..( 1976;). Lambda repressor regulates the switch between PR and Prm promoters. Nature262:665–669 [CrossRef][PubMed]
    [Google Scholar]
  45. Wirth R., Friesenegger A., Fiedler S..( 1989;). Transformation of various species of gram-negative bacteria belonging to 11 different genera by electroporation. Mol Gen Genet216:175–177 [CrossRef][PubMed]
    [Google Scholar]
  46. Yam K. C., D’Angelo I., Kalscheuer R., Zhu H., Wang J. X., Snieckus V., Ly L. H., Converse P. J., Jacobs W. R. Jr et al.( 2009;). Studies of a ring-cleaving dioxygenase illuminate the role of cholesterol metabolism in the pathogenesis of Mycobacterium tuberculosis. PLoS Pathog5:e1000344 [CrossRef][PubMed]
    [Google Scholar]
  47. Yang X., Dubnau E., Smith I., Sampson N. S..( 2007;). Rv1106c from Mycobacterium tuberculosis is a 3β-hydroxysteroid dehydrogenase. Biochemistry46:9058–9067 [CrossRef][PubMed]
    [Google Scholar]
http://instance.metastore.ingenta.com/content/journal/micro/10.1099/mic.0.049213-0
Loading
/content/journal/micro/10.1099/mic.0.049213-0
Loading

Data & Media loading...

Most cited this month Most Cited RSS feed

This is a required field
Please enter a valid email address
Approval was a Success
Invalid data
An Error Occurred
Approval was partially successful, following selected items could not be processed due to error