1887

Abstract

Summary

Recently we have shown that an open reading frame comprising 10290 nucleotides is present on the infectious, single-stranded genome RNA of the West Nile flavivirus. We have now isolated cloned cDNA representing the 3′-terminal untranslated region of this molecule. The sequence of this region which comprises 571 nucleotides is given in this report. Recently, the nucleotide sequence of the genome RNA of the yellow fever flavivirus has been described. A comparative analysis of the 3′-terminal untranslated nucleotide sequences present in each genome suggests that in flaviviruses this region probably has the following properties. It has a heteropolymeric sequence at the 3′ terminus. It contains one or more oligonucleotide sequences that are repeated. An extensive stem and loop structure can be folded from the nucleotide sequences present at the 3′ terminus. The stem of this structure contains a conserved region introducing a defined mismatch into the stem. The loop of this structure probably contains short conserved oligonucleotide sequences in analogous positions. In both viruses the oligonucleotide CAUAUUGAC ( )CC( GGGA( AGAC lies closely in front of the sequence which can be folded into the stem of the 3′-terminal stem and loop structure and the oligonucleotide CUAGAGGUUAGAGGAGACCC is strictly conserved between both viruses. The analyses indicate that the 3′-terminal untranslated region of the genome of flaviviruses probably has rather unique characteristics of primary and secondary structure. Possible implications of these findings are discussed.

Loading

Article metrics loading...

/content/journal/jgv/10.1099/0022-1317-67-6-1183
1986-06-01
2021-08-05
Loading full text...

Full text loading...

/deliver/fulltext/jgv/67/6/JV0670061183.html?itemId=/content/journal/jgv/10.1099/0022-1317-67-6-1183&mimeType=html&fmt=ahah

References

  1. Castle E., Nowak T., Leidner U., Wengler G., Wengler G. 1985; Sequence analysis of the viral core protein and the membrane-associated proteins VI and NV2 of the flavivirus West Nile virus and of the genome sequence for these proteins. Virology 147:227–236
    [Google Scholar]
  2. Castle E., Leidner U., Nowak T., Wengler G., Wengler G. 1986; Primary structure of the West Nile flavivirus genome regions coding for all nonstructural proteins. Virology 149:10–26
    [Google Scholar]
  3. Dalbadie-Mcfarland G., Cohen L. W., Riggs A. D., Morin C., Itakura K., Richards J. H. 1982; Oligonucleotide-directed mutagenesis as a general and powerful method for studies of protein function. Proceedings of the National Academy of Sciences, U,. S,. A 79:6409–6413
    [Google Scholar]
  4. Gergen J. P., Stern R. H., Wensink P. C. 1979; Filter replicas and permanent collections of recombinant DNA plasmids. Nucleic Acids Research 7:2115–2136
    [Google Scholar]
  5. Range T., Bouloy M., Girard M. 1985; Stable secondary structures at the 3′-end of the genome of yellow fever virus (17 D vaccine strain). FEBS Letters 188:159–163
    [Google Scholar]
  6. Maniatis T., Fritsch E. F., Sambrook J. 1982 Molecular Cloning: A Laboratory Manual New York: Cold Spring Harbor Laboratory;
    [Google Scholar]
  7. Naeve C. W., Trent D. W. 1978; Identification of Saint Louis encephalitis virus mRNA. Journal of Virology 25:535–545
    [Google Scholar]
  8. Queen C., Korn L. J. 1984; A comprehensive sequence analysis for the IBM personal computer. Nucleic Acids Research 12:581–599
    [Google Scholar]
  9. Rice C. M., Lenches E. M., Eddy S. R., Shin S. J., Sheets R. L., Strauss J. H. 1985; Nucleotide sequence of Yellow fever virus: implications for flavivirus gene expression and evolution. Science 229:726–733
    [Google Scholar]
  10. Sanger F., Nicklen S., Coulson A. R. 1977; DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U,. S,. A 74:5463–5467
    [Google Scholar]
  11. Shope R. E. 1980; Medical significance of togaviruses: an overview of diseases caused by togaviruses in man and in domestic and wild vertebrate animals. In The Togaviruses: Biology, Structure, Replication pp 47–82 Edited by Schlesinger R. W. New York: Academic Press;
    [Google Scholar]
  12. Singer-Sam J., Simmer R. L., Keith D. H., Shively L., Teplitz M., Itakura K., Gartler St. M., Riggs A. 1983; Isolation of a cDNA clone for human X-linked 3-phosphoglycerate kinase by use of a mixture of synthetic oligodeoxyribonucleotides as a detection probe. Proceedings of the National Academy of Sciences, U,. S,. A. 80:802–806
    [Google Scholar]
  13. Stollar V., Schlesinger R. W., Stevens T. M. 1967; Studies on the nature of dengue virus. III. RNA synthesis in cells infected with type 2 dengue virus. Virology 33:650–658
    [Google Scholar]
  14. Wengler G., Wengler G. 1981; Terminal sequence of the genome and replicative-form RNA of the flavivirus West Nile virus: absence of poly(A) and possible role in RNA replication. Virology 113:544–555
    [Google Scholar]
  15. Wengler G., Wengler G., Gross H. J. 1978; Studies on virus-specific nucleic acids synthesized in vertebrate and mosquito cells infected with flaviviruses. Virology 89:423–437
    [Google Scholar]
  16. Wengler G., Castle E., Leidner U., Nowak T., Wengler G. 1985; Sequence analysis of the membrane protein V3 of the flavivirus West Nile virus and of its gene. Virology (in press)
    [Google Scholar]
  17. Westaway E. G. 1980; Replication of flaviviruses:. In The Togaviruses: Biology, Structure, Replication pp 531–581 Edited by Schlesinger R. W. New York: Academic Press;
    [Google Scholar]
http://instance.metastore.ingenta.com/content/journal/jgv/10.1099/0022-1317-67-6-1183
Loading
/content/journal/jgv/10.1099/0022-1317-67-6-1183
Loading

Data & Media loading...

Most cited this month Most Cited RSS feed

This is a required field
Please enter a valid email address
Approval was a Success
Invalid data
An Error Occurred
Approval was partially successful, following selected items could not be processed due to error